Impacts

---

- Fecal E. coli bacteria from pigs can potentially be transmitted to humans via meat. Certain strains could establish in human gut and cause disease.
- They could also serve as reservoirs of antibiotic resistance genes, and transmit these to bacteria harmful to humans, making antibiotics ineffective.
- Therefore, for prudent use of antibiotics, it is important to monitor the properties of these bacteria in different geographic areas of the world. The present study of E. coli from 113 pigs in Grenada showed 100% resistance to tetracycline among 10 antibiotics, and some strains were potentially harmful. However, no resistance was seen against some antibiotics, including ciprofloxacin, which is commonly used in human medicine against intestinal pathogens.

Summary

---

A total of 102 E. coli isolates recovered from 113 fecal samples of pigs from 16 pig holdings in Grenada were tested for susceptibility against 10 antimicrobial drugs. Drug resistant isolates were tested for resistance genes, and phylogenetic groups. All isolates were susceptible to amoxicillin-clavulanic acid, ceftiofur,  chloramphenicol, ciprofloxacin, gentamicin, and neomycin. Resistance to tetracycline was 100%, and 69.6% exhibited presence of tet(A) gene. Of 31 streptomycin resistant isolates, 45.1% were positive for the gene aadA. Only 2 of the 6 sulfamethoxazole-trimethprim resistant isolates had sul1 gene. Of 102 isolates, 61 belonged to phylogenetic group A, which is considered to comprise non-pathogenic commensals. Eighteen of 102 belonged to group D which could be enteropathogenic. Only 5 belonged to group B2, which may harbor extra-intestinal virulence factors for humans. Multi-resistant isolates showing resistance to tetracycline and streptomycin ,  and tetracycline and sulfamethoxazole-trimethoprim were present in all phylogenetic groups.

Introduction

---

Escherichia coli is generally considered as a commensal inhabitant of gastrointestinal tracts of humans and animals, yet some strains are known to cause serious morbidity and mortality . Drug resistant E.coli can easily be spread through water, soil and food and can be transferred from animals to people (Guardabassi et al., 2004). Increasing antimicrobial drug resistant flora in animals is a potent public health problem leading to ban of several antibiotics in food animal use (Casewell et al., 2003, Turnidge 2004). Commensal bacteria such as E.coli can serve as reservoirs of resistance genes for potentially pathogenic bacteria (van den Bogaard and Stobberingh 2000). Therefore, it is important to monitor antimicrobial resistance in ‘indicator bacteria’ such as E. coli, as recommended by the World Health Organization (2000), and to analyze the phenotypes and the mechanism of antibiotic resistance in these bacteria from food producing animals in different geographic areas/ countries.
Phylogenetic analysis of E.coli isolates classifies them into four major phylogenetic groups namely, A, B1, B2 and D (Herzer et al., 1990). Group A and B1 generally associated with commensals whereas most enteropathogenic isolates are assigned to group D, and Group B2 is associated with extra-intestinal pathotypes (Boyd and Hartl 1998, Johnson et al., 2002). Phylogenetic testing of E. coli, based on a triplex PCR has been reported recently (Clermont et al., 2000). This test is simple, reproducible and accessible to most laboratories with limited resources.
The objectives of this study were to determine the resistance phenotypes, genes associated with the phenotypes, and to characterize the phylogenetic groups in commensal E. coli isolates from healthy pigs in Grenada. To date, there have been very few published studies on antimicrobial drug resistance and phylogenetic grouping of E. coli from pigs, and none on pigs from Grenada.

Materials and Method

---

E coli isolation and identification
A total of 113 fecal samples were collected from pigs of 3 months to 3 years of age, from 16 randomly selected small scale pig holdings in Grenada in 2009. All pigs in each holdings were sampled. Ten to 15 grams feces were collected from rectum of pigs by using sterile gloves, and placed in sterile plastic containers, and transported to the microbiology research laboratory on ice. All samples were stored at -80°C until examined. For culture, each thawed sample was suspended in 5ml of trypticase broth, and a loopful (10 µL) was plated onto a MacConkey agar plate (Remel, Lennexa, KS, USA), and incubated aerobically for 18 h at 37°C. One lactose fermenting colony per sample with typical E.coli morphology was selected and tested for indole production. Indole positive isolates were presumptively identified as E. coli as suggested by Quinn et al (2002). One colony from each MacConkey plate with growth of only non-lactose fermenting colonies was tested for variant E. coli strains using the API20E bacterial identification system (BioMérieux, Mary-lEtoile, France). Isolates identified as E. coli by API20E were also included in the study despite the fact that they were non-lactose fermenting variants.
Antibiotics susceptibility tests
The isolates were tested for antimicrobial susceptibility with the standard Kirby-Bauer disk diffusion on Mueller-Hinton agar (Remel) using the following disks: amoxicillin-clavulanic acid 30 µg, ampicillin 10 µg, ceftiofur 30 µg chloramphenicol 30 µg, ciprofloxacin 5 µg, gentamicin 10 µg, neomycin 30 µg, streptomycin 10 µg, sulfamethoxazole-trimethoprim 25 µg, and tetracycline 30 µg. The zone sizes were interpreted as per NCCLS (2002), (presently, Clinical Laboratory Standards Institute/CLSI) guidelines. An E. coli strain ATCC 25922 (American type Culture Collection, Manassas, VA, USA), susceptible to all the antibiotics tested, was used as a control. For the purpose of analysis, intermediate susceptibility was considered as susceptible.
DNA extraction
The DNA was extracted as per the prtocl described earlier (Radhuoni et al, 2009). The isolates were cultured on MacConkey agar plates for 24h. One to two colonies were resuspended in 0.5ml sterile distilled water. The cells were lysed by heating at 95oC for 10 min and the supernatant was harvested by centrifugation at 12,000 rpm (8000g) for 5 min. The supernatant was used as the source of the template DNA.
Detection of antibiotics resistance genes
The presence of gene coding for following genes were studied by PCR in resistant isolates: SHV, OXA and TEM (in ampicillin resistant isolates), tetA, tetB and tetC (in tetracyclin resistant isolates), aadA (in streptomycin resistant isolates) and sul1, dhfrV and dhfrI (in SXT resistant isolates).Primer details are given in table 1.A negative control was included in all the reactions. The PCR reactions were performed in a total volume of 25 μl. Each reaction contained 1.5units of Taq polymerase (Invitrogen, Carlsbad, CA, USA ), 1× Taq DNA polymerase buffer (10 mM Tris-HCl pH 9.0, 50mM KCl, 0.1% Triton-X-100), 1.5mM MgCl2, 200μM of each deoxy nucleotide triphosphate, 20 pico moles of forward and reverse primers and 5μl of the extracted DNA in an automated thermal cycler (Appollo ATC401 Thermal Cycler, Continental Lab Products, San Diego, CA, USA). The PCR amplification condition was as follows. Amplification was conducted after an initial denaturation at 94°C for 2 min, the cycling conditions used were–denaturation at 94°C for 30 s, annealing at 58°C for 30 sec and extension at 72°C for 1 min for 35 cycles. In case of tetracycline resistant gene amplification the annealing was at 50°C for 30 sec and rest of the parameters were as described above. 10μl of the amplified products were analyzed by 2% agarose gel electrophoresis and visualized by ethidium bromide staining and ultraviolet trans-illumination. To confirm that amplification products corresponds to the target resistance gene, sequencing were done in randomly selected amplicons belonging to each resistance gene. Sequencing was done in a commercial DNA sequencing company (Amplicon Express, Pullman, WA,USA). Sequencing datawere analysed with BLAST 2.0.10 (http://blast.ncbi.nlm.nih.gov/Blast.cgi) software, which confirmed the results.
Detection of phylogenetic groups
Identification of the phylogenetic group for each E.coli was carried out on the basis of presence or absence of chuA, yjaA or tspE4.C2 genes. The primer pairs used were ChuA-F (5’GACGAACCAACGGTCAGGAT3’) and ChuA-R (5’TGCCGCCAGTACCAAAGACA3’),YjaA-F (5’TGAAGTGTCAGGAGACGCTG3’) and Yja-R(5’ATGGAGAATGCGTTCCTCAAC3’),and TspE4C2 F (5’GAGTAATGTCGGGGCATTCA3’) and TspE4C2 R (5’CGCGCCAACAAAGTATTACG3’), which generate 279-, 211-, and 152-bp fragments, respectively (Clermont et al., 2000). The isolates were assigned to one of the four major phylogenetic group, A, B1, B2 and D. The PCR was carried out as described above with modification in the annealing temperature (55oC for 30 sec) and the products were analyzed by 2% agarose gel electrophoresis

Results

---

Phenotypes of resistance and Antibiotic resistance genes among E coli isolates
A total of 102 isolates of E. coli were recovered. All isolates were susceptible to amoxicillin-clavulanic acid, ceftiofur, chloramphenicol, ciprofloxacin, gentamcin, and neomycin. Resistance to tetracycline was 100%, followed by streptomycin (30.4%), sulfamethoxazole-trimethprim (5.9%), and ampicillin (2.9%). Phenotypes of resistance and the resistance genes detected in the antimicrobial resistant E.coli are shown in Table 2. In the present study, tet(A)was the most prevalent tetracycline resistant gene detected. 71 out of the total 102 tetracycline resistant isolates (69.6%) exhibited the presence of tet(A) gene. Tet(B)  gene was detected in 9 out of the 102 isolates (8.8%) and both genes were detected in one of them. None of the Ampicillin resistant isolates was positive for any of the beta lactamase genes under study. Genes which are responsible for resistance to streptomycin (aadA), sulfonamides (sul1) and trimethoprim (dhfrV) were distributed at the rates of 45.1%, 33.3% and 16.6% among isolates resistant to these drugs.
Phenotypes of resistance patterns and Phylogenetic groups
Table 3 shows the phylogenetic groups to which the 102 antimicrobial resistant isolates belonged to. Multiple resistance (resistance to 2 or more drugs) was seen in 36.3% of isolates. Majority of the isolates in the present study are assigned to Group A (61 isolates) followed by Group B1 (18 isolates) and Group D (18 isolates). Only 5 isolates belonged to group B2.

Discussion

---

In this study, the highest prevalence of resistance was observed for tetracycline, followed by streptomycin, SXT and ampicillin. It was observed that tetracycline resistance gene was widely spread in the E. coli populations. The frequency of tetracycline resistance in commensal E. coli from pigs in Grenada is 100%. The commonly used antibiotics for treatment of pigs in Grenada are oxytetracycline, penicillin+streptomycin, and sulfadiazine-trimethoprim. Chlortetracycline is routinely used as an additive at the rate of 2 grams/ ton for pigs in Grenada. This may be the reason for the occurrence of 100% resistance to tetracycline in the present study. The values reported for tetracycline resistance in E. coli of porcine origin from other countries vary from 68% to 93% (Lee et al., 1993, Maynard et al., 2003, Hariharan et al., 2004, Boerlin et al., 2005, Stine et al. 2007, Kozak et al., 2009). More than 30 different tetracycline resistance determinants have been described to date, with tet(A), tet(B), tet(C), tet(D), and tet(E) most frequently found in tetracycline-resistant E. coli isolates (Chopra and Roberts 2001). The tet(A) gene was the most prevalent followed by tet(B) gene in the present study. While tet(A) is predominant in pathogenic strains, tet(B) may be found in both pathogenic and commensal E. coli isolates (White 2006). These two genes are associated with an active efflux mechanism of tetracycline resistance (Chopra and Roberts 2001).These two genes are predominant in E. coli isolates from livestock and food animals from other countries Boerlin et al., 2005, Guerra et al., 2003, Bryan et al., 2004). Since tetracycline resistance genes are located on mobile genetic element, they are transmissible between bacteria (Roberts 2005).
The rate of resistance to streptomycin in the present study was only 31%, whereas a study on commensal E. coli in pigs in Chile showed a rate of 84% (Martin et al., 2005). Resistance to sulfonamides and streptomycin has been reported frequently from bacteria from swine (Boerlin et al., 2005, Lanz et al ., 2003, Government of Canada 2007). Resistance to sulfamethoxazole-trimethoprim, and neomycin, two drugs used for treatment of porcine diarrhea due to E. coli was 32% and 27%, respectively in a Canadian study (Hariharan et al., 2004). A previous study (Hariharan et al., 1989) on enterotoxigenic E. coli from swine showed that the majority of strains resistant to TMS tend to show resistance to tetracycline, neomycin, and ampicillin as well. Although a small percentage isolates in the present study were resistant to sulfamethoxazole-trimethoprim, all isolates were susceptible to neomycin. Resistance to 2 or more drugs in the present study was only 36%, compared to a rate of >60% in a Chilean study in 2005, which used a similar set of drugs (Martin et al., 2005). Obviously, the drug resistance among E. coli from swine in Grenada has not reached an emergency situation, but monitoring is necessary, especially in view of the high tetracycline resistance.
The reports from other countries showing that the ampicillin resistance in E. coli strains from food animals had a unique beta lactamase blaTEM gene (Guerra et al 2003, Brinas et al 2002). However, TEM β-lactamase genes or SHV β-lactamase genes may not be present in certain animal isolates of E. coli (Ahmed et al 2010).
High level of E. coli resistance in food sources could be a cause for concern as this organism has high propensity to disseminate antimicrobial resistance genes (WHO 1997).
The higher proportion of A and B1 isolates in the present study could be explained by the fact that they were from healthy pigs, and they were of fecal origin. These groups are generally associated with commensal isolates, whereas in most cases, enteropathogenic isolates are assigned to group D. Isolates with extra-intestinal virulence factors for humans has been found frequently in group B2 (Duriez et al., 2001, Radhouani et al., 2009). The B2 and D group isolates were resistant to tetracycline, streptomycin or sulfamethoxazoe-trimethoprim. Further studies are required to understand the significance of isolates from these different phylogentic groups in porcine and human disease, especially in view of the recent observation (Carlos et al 2010) that strains from humans have more similarity to strains from pigs than the strains from other animals such as cattle, sheep, and goats.

Conclusion

---

Resistance to tetracycline is widely spread among commensal E. coli of porcine origin in Grenada, with a majority of isolates having the tet(A) gene. Rates of resistance to other drugs except for streptomycin was minimal or none, but sulfamethoxazole-trimethoprim resistance may be emerging, having presence of the concerned genes. Although the   majority of isolates belonged to non-pathogenic phylogentic group A, 22% belonged to groups B2 and D, and these may pose a hazard to humans. 

References

---

1. Ahmed, M. O., P. D. Clegg, N. J. Williams, K. E. Baptiste, and M. Bennett,2010: Antimicrobial resistance in equine faecal Escherichia coli isolates from North West England. Ann. Clin. Microbiol. Antimicrob. 9,12.
2. Boerlin, P., R. Travis, C. L. Gyles, R. Reid-Smith, N. Janecko, H. Lim, V. Nicholson, S. A. McEwen, R. Friendship, and M. Archambault, 2005: Antimicrobial resistance and virulence genes of Escherichia coli isolates from swine in Ontario. Appl. Environ. Microbiol .71,6753-6761. 
3. Boyd, E. F., and D. L. Hartl,1998: Chromosomal regions specific to pathogenic isolates of Escherichia coli have a phylogenetically clustered distribution. J Bacteriol 180,1159-1165.
4. Brinas, L., M. Zarazaga, Y. Saenz, F. Ruiz-Larrea, and C. Torres,2002: Beta-lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals. Antimicrob. Agents. Chemother. 46,3156-3163.
5. Bryan, A., N. Shapir, and M. J. Sadowsky, 2004: Frequency and distribution of tetracycline resistance genes in genetically diverse, nonselected, and nonclinical Escherichia coli strains isolated from diverse human and animal sources. Appl.Environ. Microbiol. 70,2503-2507.
6. Carlos, C., M. M. Pires, N. C. Stoppe, E. M. Hachich, M. I. Sato, T. A. Gomes, L. A. Amaral, and L. M. Ottoboni,2010: Escherichia coli phylogenetic group determination and its application in the identification of the major animal source of fecal contamination. BMC. Microbiol. 10,161. 
7. Casewell, M., C. Friis, E. Marco, P. McMullin, and I. Phillips, 2003: The European ban on growth-promoting antibiotics and emerging consequences for human and animal health. J. Antimicrob. Chemother .52,159-161.
8. Chopra, I., and M. Roberts, 2001: Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 65,232-260 ; second page, table of contents.
9. Clermont, O., S. Bonacorsi, and E. Bingen, 2000: Rapid and simple determination of the Escherichia coli phylogenetic group. Appl. Environ. Microbiol. 66,4555-4558.
10. Duriez, P., O. Clermont, S. Bonacorsi, E. Bingen, A. Chaventre, J. Elion, B. Picard, and E. Denamur, 2001: Commensal Escherichia coli isolates are phylogenetically distributed among geographically distinct human populations. Microbiol. 147,1671-1676.
11. Government of Canada,2007: Canadian integrated program for antimicrobial resistance surveillance (CIPARS) 2005. Public Health Agency of Canada,Guelph, Ontario, 
12. Guardabassi, L., S. Schwarz, and D. H. Lloyd, 2004: Pet animals as reservoirs of antimicrobial-resistant bacteria. J. Antimicrob. Chemother. 54,321-332.
13. Guerra, B., E. Junker, A. Schroeter, B. Malorny, S. Lehmann, and R. Helmuth, 2003: Phenotypic and genotypic characterization of antimicrobial resistance in German Escherichia coli isolates from cattle, swine and poultry. J. Antimicrob. Chemother. 52,489-492.
14. Hariharan, H., J. W. Bryenton, J. S. Onge, J. R. Long, and M. O. Ojo, 1989: Resistance to trimethoprim-sulfamethoxazole of Escherichia coli isolated from pigs and calves with diarrhea. Can. Vet. J. 30,348-349.
15. Hariharan, H., M. Coles, D. Poole, and R. Page, 2004: Antibiotic resistance among enterotoxigenic Escherichia coli from piglets and calves with diarrhea. Can. Vet. J. 45,605-606.
16. Herzer, P. J., S. Inouye, M. Inouye, and T. S. Whittam,1990:Phylogenetic distribution of branched RNA-linked multicopy single-stranded DNA among natural isolates of Escherichia coli. J. Bacteriol. 172,6175-6181.
17. Johnson, J. R., C. van der Schee, M. A. Kuskowski, W. Goessens, and A. van Belkum,2002: Phylogenetic background and virulence profiles of fluoroquinolone-resistant clinical Escherichia coli isolates from the Netherlands. J. Infect. Dis. 186,1852-1856.
18. Kozak, G. K., P. Boerlin, N. Janecko, R. J. Reid-Smith, and C. Jardine,2009: Antimicrobial resistance in Escherichia coli isolates from swine and wild small mammals in the proximity of swine farms and in natural environments in Ontario, Canada. Appl.Environ. Microbiol .75,559-566.
19. Lanz, R., P. Kuhnert, and P. Boerlin, 2003: Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Vet. Microbiol. 91,73-84.
20. Lee, C., B. E. Langlois, and K. A. Dawson, 1993: Detection of tetracycline resistance determinants in pig isolates from three herds with different histories of antimicrobial agent exposure. Appl Environ Microbiol 59,1467-1472.
21. Martin, S.M., L.Campos,V. Bravo, M. Adsane, and C.Borie, 2005:Evaluation of antimicrobial resistance using indicator bacteria isolated from pigs and poultry in Chile. Int.  J.  Appl. Res Vet.  Med., 3, 171-178, 22. Maynard, C., J. M. Fairbrother, S. Bekal, F. Sanschagrin, R. C. Levesque, R. Brousseau, L. Masson, S. Lariviere, and J. Harel,2003: Antimicrobial resistance genes in enterotoxigenic Escherichia coli O149:K91 isolates obtained over a 23-year period from pigs. Antimicro. Agents. Chemother. 47,3214-3221.
23. National Committee for Clinical Laboratory Standards. Performance standard for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. 2nd ed. Approved standard M31-A2, 2002, NCCLS, Wayne, PA.
24. Quinn, P. J., Markey, B.K., Carter, M. E., Donnelly, W. J., Leonard F. C,2002: Veterinary Microbiology and Microbial Disease, Blackwell Science, Oxfot, UK.
25. Radhouani, H., P. Poeta, G. Igrejas, A. Goncalves, L. Vinue, and C. Torres,2009: Antimicrobial resistance and phylogenetic groups in isolates of Escherichia coli from seagulls at the Berlengas nature reserve. Vet. Rec. 165,138-142.
26. Roberts, M. C, 2005: Update on acquired tetracycline resistance genes. FEM. Microbiol. Lett. 245,195-203.
27. Stine, O. C., J. A. Johnson, A. Keefer-Norris, K. L. Perry, J. Tigno, S. Qaiyumi, M. S. Stine, and J. G. Morris, Jr., 2007: Widespread distribution of tetracycline resistance genes in a confined animal feeding facility. Int. J. Antimicrob. Agents. 29,348-352.
28. Turnidge, J., 2004: Antibiotic use in animals--prejudices, perceptions and realities. J. Antimicrob. Chemother. 53,26-27. 
29. van den Bogaard, A. E.  and Stobberingh, E. E,2000: Epidemiology of resistance to antibiotics. Links between animals and humans. Int.  J. Antimicrob.l Agents. 14, 327-335.
30. Van, T. T., J. Chin, T. Chapman, L. T. Tran, and P. J. Coloe, 2008: Safety of raw meat and shellfish in Vietnam: an analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. Int. J. Food. Microbiol. 124,217-223.
31. White, D.G.,2006:Antimicrobial resistance in pathogenic Escherichia coli from animals. In:  Antimicrobial Resistance in Bacteria of Animal Origin. Aarestrup FM (Ed.),American Society for Microbiology,Washington, DC. 145-166.
32. World Health Organization. ”Global Principles for the Containment of Antimicrobial Resistance in Animals Intended for Food”, WHO, Geneva, Switzerland, 2000.
33. WHO, “The medical impact of the use of antimicrobials in food animals. Report of a WHO Meeting. Berlin, Germany, 13–17 October 1997.  DocumentWHO/EMC/ZOO/97.4”.http://whqlibdoc.who.int/hq/1997/WHO_EMC_ZOO_97.4.pdf,1997.

Source(s) of Funding

---

none

Competing Interests

---

none

Disclaimer

---

This article has been downloaded from WebmedCentral. With our unique author driven post publication peer review, contents posted on this web portal do not undergo any prepublication peer or editorial review. It is completely the responsibility of the authors to ensure not only scientific and ethical standards of the manuscript but also its grammatical accuracy. Authors must ensure that they obtain all the necessary permissions before submitting any information that requires obtaining a consent or approval from a third party. Authors should also ensure not to submit any information which they do not have the copyright of or of which they have transferred the copyrights to a third party.
Contents on WebmedCentral are purely for biomedical researchers and scientists. They are not meant to cater to the needs of an individual patient. The web portal or any content(s) therein is neither designed to support, nor replace, the relationship that exists between a patient/site visitor and his/her physician. Your use of the WebmedCentral site and its contents is entirely at your own risk. We do not take any responsibility for any harm that you may suffer or inflict on a third person by following the contents of this website.